View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_115 (Length: 236)
Name: NF2495_high_115
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_115 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 22039774 - 22039993
Alignment:
| Q |
1 |
tgatgagatatggccacaataccctttgcttcctgtcgatccctttgagagagcccaagctcggttctgggtaaaatatgtcgatgatattgtaagttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22039774 |
tgatgagatatggccacaataccctttgcttcctgtcgatccctttgagagagcccaagctcggttctgggtaaaatatgtcgatgatattgtaagttta |
22039873 |
T |
|
| Q |
101 |
atcatatgcaatttttcttagctttcattcgcataccattaaaatgttaatttgagtataggacaaaacttaggtacaattttagtcctttgattggttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22039874 |
atcatatgcaatttttcttagctttcattcgcataccattaaaatgttaatttgagtataggacaaaacttaggtacaattttagtcctttgattggtcg |
22039973 |
T |
|
| Q |
201 |
aggtgaaattgggaccaaag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
22039974 |
aggtgaaattgggaccaaag |
22039993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 40325968 - 40325882
Alignment:
| Q |
1 |
tgatgagatatggccacaataccctttgcttcctgtcgatccctttgagagagcccaagctcggttctgggtaaaatatgtcgatga |
87 |
Q |
| |
|
||||||||||||||||||| || | |||||||||| ||||| | ||| ||||| ||||| || || ||||| |||||||||||||| |
|
|
| T |
40325968 |
tgatgagatatggccacaaaacacattgcttcctgctgatccttatgatagagctcaagcccgattttgggttaaatatgtcgatga |
40325882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 40343498 - 40343412
Alignment:
| Q |
1 |
tgatgagatatggccacaataccctttgcttcctgtcgatccctttgagagagcccaagctcggttctgggtaaaatatgtcgatga |
87 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||| | ||| ||||| ||||| || || ||||| |||||||||||||| |
|
|
| T |
40343498 |
tgatgagatatggccacacaactcattgcttcctgctgatccttatgatagagctcaagcccgattttgggttaaatatgtcgatga |
40343412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University