View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_116 (Length: 234)
Name: NF2495_high_116
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_116 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 8 - 214
Target Start/End: Original strand, 7753201 - 7753400
Alignment:
| Q |
8 |
gagtgagatgaagagtacatatttggaaccaaaaa-ggaattttttatcttaccattaaaggaaaccaatattttttcatcttaagatcagcaaactgga |
106 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| |||| ||| | | ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7753201 |
gagtgagaagaagaatacatatttggaaccaaaaaaggaaattt--agcataccattaaaggaaaccaatattttttcatcttaagatctgcaaactgga |
7753298 |
T |
 |
| Q |
107 |
tggtaacaccttttcccattgattccaccgatttctacnnnnnnnnnnnnnnnnntgattataacttgcaccttgtgtatatgttgaatcttctgttttc |
206 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7753299 |
ttgtaacaccttttcccattgattccacagatttctac------aaaaaaaaaaatgattataacttgcaccttgtgtatatattgaatcttctgttttc |
7753392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University