View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_29 (Length: 398)
Name: NF2495_high_29
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 16 - 384
Target Start/End: Complemental strand, 53704973 - 53704605
Alignment:
| Q |
16 |
ctcaatgaaacccctcagattcgtctttttaatcccttaacatgtgtcactctttttcttcctcctattcacactttccctaatgtggtaagctttgatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53704973 |
ctcaatgaaacccctcagattcgtctttttaatcccttaacatgtgtcactctttttcttcctcctattcacactttccctaacgtggtaagctttgatt |
53704874 |
T |
 |
| Q |
116 |
attcaaatatcggtcgtgagtattcggttacaaacgatagttatttaagattttttagtttgagacaaatgtgtgatgatttcatagctaaaattgtatt |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704873 |
attcaaatatcggccgtgagtattcggttacaaacgatagttatttaagattttttagtttgagacaaatgtgtgatgatttcatagctaaaattgtatt |
53704774 |
T |
 |
| Q |
216 |
ttcaacaagcccttcgcttagcgatgaattcgttgcacttgctattgttgatgtttatagttgtaataatctggctttctgtaaaaaaggttatgattct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704773 |
gtcaacaagcccttcgcttagcgatgaattcgttgcacttgctattgttgatggttatagttgtaataatctggctttctgtaaaaaaggttatgattct |
53704674 |
T |
 |
| Q |
316 |
tggattttcctaaccaaaaagaatgattactatttttgggaagatgttgtgtattacaatggattgttt |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704673 |
tggattttcctaaccaaaaagaatgattactatttttgggaagatgttgtgtattacaatggattgttt |
53704605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University