View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_56 (Length: 288)
Name: NF2495_high_56
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 7 - 274
Target Start/End: Original strand, 7081553 - 7081820
Alignment:
| Q |
7 |
tgagatgaagattttgaaggcatgatggaagcttttctgaagcaaagatttgaagggatagtgttttctaagtaagaaacttcttcattgaaggaagtgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7081553 |
tgagatgaagattttgaaggcatgatggaagcttttctgaagcaaagatttgaagggatagtgttttctaagtaagaaacttcttcattgaaggaagtgt |
7081652 |
T |
 |
| Q |
107 |
gagggaaaggttgtgaatttgggaagatgaagctacctcttgtgtaagaaactgaggagagtgtaaagttaaggtgagtgtttgcaaagtagattaaggg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7081653 |
gagggaaaggttgtgaatttgggaagatgaagctacctcttgtgtaagaaactgaggagagtgtaaagttaaggtgagtgtttgcaaagtagattaaggg |
7081752 |
T |
 |
| Q |
207 |
aatgatggatttgagaagttgtgtagttccacaagttttgattatgatctttgttggatatacaaaga |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7081753 |
aatgatggatttgagaagttgtgtagttccacaagttttgattatgatctttgttggatatacaaaga |
7081820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 16 - 152
Target Start/End: Complemental strand, 49020237 - 49020101
Alignment:
| Q |
16 |
gattttgaaggcatgatggaagcttttctgaagcaaagatttgaagggatagtgttttctaagtaagaaacttcttcattgaaggaagtgtgagggaaag |
115 |
Q |
| |
|
||||| || |||||||||||||||||||| ||||||||||||||||||||||| |||||| || | ||||| ||||||||| |||| |||||||| |
|
|
| T |
49020237 |
gatttagagggcatgatggaagcttttctatggcaaagatttgaagggatagtgtcttctaaataggttacttcgtcattgaagcttgtgtaagggaaag |
49020138 |
T |
 |
| Q |
116 |
gttgtgaatttgggaagatgaagctacctcttgtgta |
152 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
49020137 |
gttgtgcatttgggaagatgaagcttcctcttgtgta |
49020101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 211 - 274
Target Start/End: Complemental strand, 49020045 - 49019982
Alignment:
| Q |
211 |
atggatttgagaagttgtgtagttccacaagttttgattatgatctttgttggatatacaaaga |
274 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
49020045 |
atggatttgagaagttgggttgttccacatgttttgattatgatcttagttggataaacaaaga |
49019982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University