View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2495_high_58 (Length: 283)

Name: NF2495_high_58
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2495_high_58
NF2495_high_58
[»] chr8 (2 HSPs)
chr8 (1-77)||(39498916-39498992)
chr8 (242-273)||(39498731-39498762)


Alignment Details
Target: chr8 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 39498992 - 39498916
Alignment:
1 ccaagtctcatgaaccatgctgctggttcctcaattgtgttccctatttatggcaatgtttatcctgttgggtatga 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39498992 ccaagtctcatgaaccatgctgctggttcctcaattgtgttccctatttatggcaatgtttatcctgttgggtatga 39498916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 242 - 273
Target Start/End: Complemental strand, 39498762 - 39498731
Alignment:
242 gaaagatgtgagtatccaaattcatacctttg 273  Q
    ||||||||||||||||||||||||||||||||    
39498762 gaaagatgtgagtatccaaattcatacctttg 39498731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University