View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_62 (Length: 280)
Name: NF2495_high_62
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 55 - 220
Target Start/End: Complemental strand, 928013 - 927849
Alignment:
| Q |
55 |
tccaactttaataagtttcatttttcaatcataattttcttttaatattgaaatctatctttagaatcaattctgatgtattacannnnnnnnnnnnnng |
154 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
928013 |
tccaactttaatacgtttcatttttcaatcataattttcttttaatattgaaatctatctttagaatcaattctgatgtattaca-tttttctttttttg |
927915 |
T |
|
| Q |
155 |
tgatatttgaggtttgccttgttaagaaaggaaagtaacaggcaagcgaagttaaaacagtcttag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
927914 |
tgatatttgaggtttgccttgttaagaaaggaaagtaataggcaagcgaagttaaaacagttttag |
927849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 928125 - 928079
Alignment:
| Q |
15 |
agcagagatatgatcatgtttagtgttctttctaatgatctccaact |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
928125 |
agcagagatatgatcatgtttagtgttctttctaatgatctccaact |
928079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 223 - 264
Target Start/End: Complemental strand, 927297 - 927256
Alignment:
| Q |
223 |
tattatattatgagtaatctctataaggtgctgcttatgctt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
927297 |
tattatattatgagtaatctctataaggtgctgcttatgctt |
927256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 939044 - 938998
Alignment:
| Q |
15 |
agcagagatatgatcatgtttagtgttctttctaatgatctccaact |
61 |
Q |
| |
|
|||||||||||||| || || ||||||||||||| |||||||||||| |
|
|
| T |
939044 |
agcagagatatgattattttcagtgttctttctactgatctccaact |
938998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University