View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_87 (Length: 246)
Name: NF2495_high_87
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_87 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 32 - 227
Target Start/End: Original strand, 1992465 - 1992659
Alignment:
| Q |
32 |
tgctgcatttttagaactaaatttaaaactaaattcaagatcttccgcactctcttggtcatggcagtgtcacttaacaacnnnnnnngtcttgtatgta |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1992465 |
tgctgcatttttagaactaaatttaaaactaaattcaagatcttccacactctcttggtcatggcagtgtcacttaacaactttttttgtcttgtatgta |
1992564 |
T |
 |
| Q |
132 |
atttttatgtgaaaataaagttgtgtttttgaaattaaatatcttcttatttttatctttaattccatctgtgtatgtatgtcggtaacaatttgc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1992565 |
atttttatgtgaaaataaagttgtgtttttgaaattaaatatcttctta-ttttatctttaattccatctgtgtatgtatgtcggtaacactttgc |
1992659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University