View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_97 (Length: 240)
Name: NF2495_high_97
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_97 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 34261044 - 34261261
Alignment:
| Q |
1 |
ttgaaaatgagatggagcaagaagtcctggaagaaggcaagtgttatatggcgaaagaaatatctttatgtcttctgatttattttatcatagggtggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34261044 |
ttgaaaatgagatggagcaagaagtcctggaagaaggcaagtgttatatggcgaaagaaatatctttatgtcttctgatttattttatcatagggtggtg |
34261143 |
T |
|
| Q |
101 |
tcataaatcaatttcttttttatggcaggttatcatatttgttgataactcaggtgcagatataattttaggtattttgccatttgcaagggagctcctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34261144 |
tcataaatcaatttcttttttatggcaggttatcatatttgttgataactcaggtgcagatataattttaggtattttgccatttgcaagggagctcctt |
34261243 |
T |
|
| Q |
201 |
cggcgtgggagtcaggtt |
218 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
34261244 |
cggcgtgggaatcaggtt |
34261261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 64 - 222
Target Start/End: Original strand, 34251204 - 34251361
Alignment:
| Q |
64 |
ctttatgtcttctgatttattttatcatagggtggtgtcataaatcaatttcttttttatggcaggttatcatatttgttgataactcaggtgcagatat |
163 |
Q |
| |
|
|||||||||||||||| ||||||| | ||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34251204 |
ctttatgtcttctgatgtattttagccaagggtagtgtcataa-tcaatttctttttcatggcaggttatcatatttgttgataactcgggtgcagatat |
34251302 |
T |
|
| Q |
164 |
aattttaggtattttgccatttgcaagggagctccttcggcgtgggagtcaggtttgca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34251303 |
aattttaggtattttgccatttgcaagggagctccttcggcgtgggagtcaggtttgca |
34251361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 34251124 - 34251186
Alignment:
| Q |
1 |
ttgaaaatgagatggagcaagaagtcctggaagaaggcaagtgttatatggcgaaagaaatat |
63 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
34251124 |
ttgaaaataagatggagcaagaagtcttggaaaaaggcaagtgtcatatggttaaagaaatat |
34251186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 125 - 220
Target Start/End: Complemental strand, 20862103 - 20862008
Alignment:
| Q |
125 |
gcaggttatcatatttgttgataactcaggtgcagatataattttaggtattttgccatttgcaagggagctccttcggcgtgggagtcaggtttg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||| |||||||| || ||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
20862103 |
gcaggttatcatatttgttgataactcaggtgctgatattattttgggtattttaccgtttgccagagagcttcttcggcgtgggagtcaggtttg |
20862008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University