View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_103 (Length: 241)
Name: NF2495_low_103
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_103 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 241
Target Start/End: Original strand, 176126 - 176363
Alignment:
| Q |
4 |
aaatgaagatttattcttggtatcagtataacaacttgataaaatgagttacaacccctaaatagatttaaatactacctacacaatcagtaggtataaa |
103 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
176126 |
aaatgaagatttattcttggtattagtataacaacttgataaaatgagttacaacccctaaatagatttaaatactacctacacaatgagtaggtataaa |
176225 |
T |
 |
| Q |
104 |
tggaggaaaaacccaaaaagagaacatagtaaagcaagtatttttagagagagatacaaccttatctttgtagagttgtttgagttgagcaacaccttgg |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
176226 |
tggaggaaaaacccaaaaacagaacatagtaaagaaagtatttttagagagagatacaaccttatctttgtagagttgtttgagttgagcaacaccttgg |
176325 |
T |
 |
| Q |
204 |
atacctttctgaacgagttttctgaaatttctgggacc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
176326 |
atacctttctgaacgagttttctgaaatttctgggacc |
176363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University