View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_109 (Length: 238)
Name: NF2495_low_109
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_109 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 49729150 - 49729371
Alignment:
| Q |
17 |
atatactagtagtatatttttgtatcgagagcatagcaatatattctattattagtcaacgaatatttaatcaaattctacaattaacccataaaatact |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49729150 |
atatactagtagtatatttttttatcgagagcatagcaatatattctattattagtcaacgaatatttaatcaaattctacaattaacccataaaatact |
49729249 |
T |
|
| Q |
117 |
ctagaaactcgatagaacaatagtattattttgatttttgatgagtctctatgtaacagtattgataggcatgtttaaagggccaagaagagaccataga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49729250 |
ctagaaactcgatagaacaatagtattattttgatttttgatgagtctctatgtaacagtattgataggcatgtttaaagggccaagcagagaccataga |
49729349 |
T |
|
| Q |
217 |
tttttccgcgttgactttggct |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49729350 |
tttttccgcgttgactttggct |
49729371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University