View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_116 (Length: 237)
Name: NF2495_low_116
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_116 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 12642809 - 12642596
Alignment:
| Q |
8 |
aaagaacacaagttatatggttgttctgaagttgtagatcagactatatgattttaagttgtgggctgcaaccgcagttgcagcagtaatatcagagatt |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12642809 |
aaagaacacaagttatatgattgttctgaagctgtagatcagactatatgattttaagttgtgggctgcgaccgcagttgcagcagtaatatcagagatt |
12642710 |
T |
 |
| Q |
108 |
ttgaagtttctatgacaacatcgcaattgcaaattcgaccacctcagcggcattttctcaggtttcaccgtaatatgaaggtttgcaacataaccgaagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
12642709 |
ttgaagtttctatgacaacatcgcaattgcaaattcgatcacctcagcggcattttctcaggtttcacagtaatatgaaggtctgcaacataaccgaagc |
12642610 |
T |
 |
| Q |
208 |
cacaatctgaaacc |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12642609 |
cacaatctgaaacc |
12642596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University