View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_124 (Length: 231)
Name: NF2495_low_124
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_124 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 54 - 216
Target Start/End: Original strand, 38709941 - 38710103
Alignment:
| Q |
54 |
agggacagggacagagtcagaaaccataccttgagctatctcaggtgctggcttctgagctgcctttgtttgtagcttatgagtgtccggccttgtcagc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38709941 |
agggacagggacagagtcagaaaccataccttgagctatctcaggtgttagcttctgagctgcctttgtttgtagcttatgagtgtccggccttgtcagc |
38710040 |
T |
 |
| Q |
154 |
ctctgatgcgacattctttgatttgatataacaaactctaacacattgatgtgtgctggtggt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38710041 |
ctctgatgcgacattctttgatttgatataacaaactctaacacattgatgtgtgctggtggt |
38710103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University