View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_59 (Length: 290)
Name: NF2495_low_59
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 22 - 285
Target Start/End: Complemental strand, 41179507 - 41179247
Alignment:
| Q |
22 |
gttagttggttatagatataattcattagtattgatgcacacagtttagttcaagtttccttttcaataacagttggtttggtattattattgatagtat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179507 |
gttagttggttatagatataattcattagtattgatgcacacagtttagttcaagtttccttttcaataacagttggtttggtattattattgatagtat |
41179408 |
T |
|
| Q |
122 |
tcattcacctttgaaaattcttgataatcnnnnnnnnnnnncactttgccgtacacctttctcatatatatttactttcttcttcatcaccggttaa-tt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
41179407 |
tcattcacctttgaaaattcttgataatc----atatatatcactttgccgtacacctttctcatatatatttactttcttcttcatcactggttaattt |
41179312 |
T |
|
| Q |
221 |
tgtttaggtttggtgcagttgacagtttagaagaaaaacaaaatgcagtcaagtcctttgcttct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179311 |
tgtttaggtttggtgcagttgacagtttagaagaaaaacaaaatgcagtcaagtcctttgcttct |
41179247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University