View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_63 (Length: 283)
Name: NF2495_low_63
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 39498992 - 39498916
Alignment:
| Q |
1 |
ccaagtctcatgaaccatgctgctggttcctcaattgtgttccctatttatggcaatgtttatcctgttgggtatga |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39498992 |
ccaagtctcatgaaccatgctgctggttcctcaattgtgttccctatttatggcaatgtttatcctgttgggtatga |
39498916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 242 - 273
Target Start/End: Complemental strand, 39498762 - 39498731
Alignment:
| Q |
242 |
gaaagatgtgagtatccaaattcatacctttg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39498762 |
gaaagatgtgagtatccaaattcatacctttg |
39498731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University