View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_78 (Length: 260)
Name: NF2495_low_78
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 244
Target Start/End: Complemental strand, 43789411 - 43789180
Alignment:
| Q |
14 |
gaactgaactggttcggtggcatctgcggcggaacaacgtcgctgggaagaaaattcgacggacttgcagagatgttattcccaggccaaacgtcattga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43789411 |
gaactgaactggttcggtggcatctgcggcggaacaacgtcgctgggaagaaaattcgacggacttgcagagatgttattcccaggccaaacgtcattga |
43789312 |
T |
|
| Q |
114 |
aagataccaccgtctgcgactgcatgcttgtaacggtgggaaagacctcaaacggcatcggtggtaatgtatttgtcgagaaaaatcccgacgacatcac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43789311 |
aagataccaccgtctgcgactgcatgcttgtaactgtgggaaagacctcaaacggcatcggtggtaatgtatttgtcgagaaaaatcccgacgacat-ac |
43789213 |
T |
|
| Q |
214 |
cagcatgt--taaactccggcaccattacctca |
244 |
Q |
| |
|
| || ||| ||||||||||||||||||||||| |
|
|
| T |
43789212 |
cggcgtgttataaactccggcaccattacctca |
43789180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University