View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_82 (Length: 257)
Name: NF2495_low_82
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 40557172 - 40556948
Alignment:
| Q |
16 |
cttcctcccttttttcttttgaggcacataatccaaagacaattcctctgttggtgtcagaaagttctcttcaatcttacctattggaatggacaagcgg |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40557172 |
cttcctcccttttttattttgaggcacataatccaaagacaattcctctgttggtgtcagaaagttctcttcaatcttacctattggaatggacaagcgg |
40557073 |
T |
 |
| Q |
116 |
ctttgatctttgtccacgtcactcattgtcagttccttctggatcaccaacttcacctcacaacctcccatttgttccatcttttctttaaacaccaatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
40557072 |
ctttgatctttgtccacgtcactcattgtcagttccttctggatcaccaacttcacctcacaaccttccatttgttcaatcttttctttaaacgccaatg |
40556973 |
T |
 |
| Q |
216 |
gaagctccggtttctcttcttgcac |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40556972 |
gaagctccggtttctcttcttgcac |
40556948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University