View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_87 (Length: 250)
Name: NF2495_low_87
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_87 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 12642955 - 12643199
Alignment:
| Q |
1 |
ccaaagaaaaatgttgtattatccttagccattaaggtttttgcttaggcattaaggtctcatgatcctgtaagcaccgtgatgcagcaccgccgtttac |
100 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12642955 |
ccaaagaaaaacgttgcattatccttagccattaaggtttttgcttaggcattaaggtctcatgatcctgtaagcaccgcgatgcagcaccgccgtttac |
12643054 |
T |
 |
| Q |
101 |
tttctaagcatataagactttcttttcttaagtattaagtaactaagcctataaaagactatgctaataacctttcatgaatcaatattgcaaatcaatt |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12643055 |
tttctaagcatataagacttgcttttcttaagtattaagtaactaagcctataaaagactatgctaataacctttcatgaatcaatattgcaaatcaatt |
12643154 |
T |
 |
| Q |
201 |
tgtgaatgaaaatatagtgttgttgtaaaatctcttcttctctct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12643155 |
tgtgaatgaaaatatagtgttgttgtaaaatctcttcttctctct |
12643199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University