View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_91 (Length: 249)
Name: NF2495_low_91
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_91 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 8 - 193
Target Start/End: Complemental strand, 36417108 - 36416920
Alignment:
| Q |
8 |
atgaagaaccaagcacgttcccccctagcgtatgccagccttgttttggataaataaagaaattctt--gtttgaaataaatgcagaagaaaggatggac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36417108 |
atgaagaaccaagcacgttcccccctagcgtatgccagccttgttttggataaataaagaatttcttttgtttgaaataaatgcagaagaaaggatggac |
36417009 |
T |
|
| Q |
106 |
caaccacgttccttcttgtgtctagtcaaagtattgctcaaaataaacaag-nnnnnnnncacactgacacaggcagtggaatgtgtgt |
193 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
36417008 |
caaccacgttccttcttgcgtctagtcaaagtattgctcaaaataaacaagaaaaaaaaacacactgacacaggcagtgaaatgtgtgt |
36416920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University