View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_low_96 (Length: 246)
Name: NF2495_low_96
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_low_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 50153817 - 50154014
Alignment:
| Q |
1 |
ttgttcttctgatttcagcaacttttaagctagaacaaggttgaaattaaccgtatatatatcatgttaagtatactttgaaaggtggaaaggacatgaa |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50153817 |
ttgttcttctgatttcaacaacttttaagttagaacaagattgaaattaaatgtatatatattatgttaagtatactttgaaaggtggaaatgacatgaa |
50153916 |
T |
 |
| Q |
101 |
aataagtgtatcatgtgcgtcatcattatgtgtcctgcatcttattaccacatgaaattcttctataaatatctcaatgtatatatgtaagcatacta |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50153917 |
aataagtgtatcatgtgtgtcatcattatgtgtcctgcatcttagtaccacatgaaatatttctataaatatctcaatgtatatatgtaagcatacta |
50154014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University