View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496-1-Insertion-19 (Length: 148)
Name: NF2496-1-Insertion-19
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496-1-Insertion-19 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 6e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 6e-60
Query Start/End: Original strand, 24 - 148
Target Start/End: Complemental strand, 20203108 - 20202984
Alignment:
| Q |
24 |
gcatcattctacattgaaggagatgccctcacgtggtgccattggatgcactctaatgcttagcttcattcttgacctactattctccatgctcttgaac |
123 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20203108 |
gcatcattctacatggaaggagatgccctcacgtggtgccattggatgcactctaatggttagcttcattcttgacctactattctccatgctcttgaac |
20203009 |
T |
|
| Q |
124 |
tgcctttttccccttcatactttga |
148 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
20203008 |
tgcctttttccccttcatactttga |
20202984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 117; E-Value: 6e-60
Query Start/End: Original strand, 24 - 148
Target Start/End: Complemental strand, 22097131 - 22097007
Alignment:
| Q |
24 |
gcatcattctacattgaaggagatgccctcacgtggtgccattggatgcactctaatgcttagcttcattcttgacctactattctccatgctcttgaac |
123 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22097131 |
gcatcattctacatggaaggagatgccctcacgtggtgccattggatgcactctaatggttagcttcattcttgacctactattctccatgctcttgaac |
22097032 |
T |
|
| Q |
124 |
tgcctttttccccttcatactttga |
148 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
22097031 |
tgcctttttccccttcatactttga |
22097007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 37512 times since January 2019
Visitors: 2878