View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2496-1-Insertion-3 (Length: 113)

Name: NF2496-1-Insertion-3
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2496-1-Insertion-3
NF2496-1-Insertion-3
[»] chr3 (2 HSPs)
chr3 (74-113)||(24354936-24354975)
chr3 (8-46)||(24355005-24355043)


Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000004; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 74 - 113
Target Start/End: Complemental strand, 24354975 - 24354936
Alignment:
74 tacctctaactttcttatgaggtcgaggagaaacgaaagg 113  Q
    ||||||||||||||||||||||||||||||||||||||||    
24354975 tacctctaactttcttatgaggtcgaggagaaacgaaagg 24354936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 24355043 - 24355005
Alignment:
8 ttttacatagaaaattgcatcaatccaatatctatatgt 46  Q
    ||||||||||||||||||||||||||||||| |||||||    
24355043 ttttacatagaaaattgcatcaatccaatatgtatatgt 24355005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University