View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496-1-Insertion-6 (Length: 77)
Name: NF2496-1-Insertion-6
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496-1-Insertion-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 6e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 36357536 - 36357608
Alignment:
| Q |
1 |
ctaatgtactccagcagggtgcatatgttagcgctcttattgattaaagacaccaccaaatagtggaatagagattt |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
36357536 |
ctaatgtactccagcagggtgcatatgttagcgctcttattgatt-aaga---caccaaatagtgcaatagagattt |
36357608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 38578 times since January 2019
Visitors: 2990