View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496-Insertion-14 (Length: 133)
Name: NF2496-Insertion-14
Description: NF2496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496-Insertion-14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 8e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 7 - 133
Target Start/End: Complemental strand, 40310453 - 40310327
Alignment:
| Q |
7 |
aggatcttcatcatatgattgaggagtatgaagagcttgaaagggctggaggatctcaacgacttaggatttctctcgtaacttcaaatgaatctgagag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40310453 |
aggatcttcatcatatgattgaggagtatgaagagcttgaaagagctggaggatctcaacgacttaggatttttctcgtaacttcaaatgaatctgagag |
40310354 |
T |
|
| Q |
107 |
tccaagttctaatgaatcaagagtcaa |
133 |
Q |
| |
|
||||||||||||||||| ||||||||| |
|
|
| T |
40310353 |
tccaagttctaatgaattaagagtcaa |
40310327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University