View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496-Insertion-16 (Length: 52)
Name: NF2496-Insertion-16
Description: NF2496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496-Insertion-16 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.000000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 28592932 - 28592972
Alignment:
| Q |
12 |
cattccttcaaaaaactttgttcttgcctgttttctgctag |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28592932 |
cattccttcaaaaaactttgttcttgcctgttttctgctag |
28592972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University