View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496-Insertion-8 (Length: 383)
Name: NF2496-Insertion-8
Description: NF2496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496-Insertion-8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 26 - 316
Target Start/End: Complemental strand, 4706973 - 4706683
Alignment:
| Q |
26 |
gaatgtattgaccccacaccaaattttttgcatcatagagtgtcccacaagtacctattgcaacattgtcgccaagtcctagtcttcttttcagatccgt |
125 |
Q |
| |
|
||||| ||| ||||||||||| ||||| |||||||||| ||||||||| ||| ||||||||||||| || || ||||||| | |||||||||||| | |
|
|
| T |
4706973 |
gaatgaatttaccccacaccatattttgagcatcatagattgtcccacatgtagctattgcaacattatcatcatatcctagtttccttttcagatcctt |
4706874 |
T |
|
| Q |
126 |
taatctatgcttcttttctgttttagctttctttgacaatagatccttcaatctacacttcaatactgattcatcatcaagttgatcatgtatagatatt |
225 |
Q |
| |
|
| || |||||||||||||| |||| |||||||||||||||||||||||||||||| | || ||| |||||||||||||| ||||||| ||||||||| || |
|
|
| T |
4706873 |
tgatttatgcttcttttctttttttgctttctttgacaatagatccttcaatctaaattttaatcctgattcatcatcaggttgatcttgtatagatctt |
4706774 |
T |
|
| Q |
226 |
aaactacactcgctccattgtttggtattagcaacgtcgaatataactacaagtctatggctgacaaagatgaactgcctttcaataaaca |
316 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||| | ||| |||| || |||||||| || ||||||||||| |
|
|
| T |
4706773 |
aaactacacttgctccattgtttggtattagcaacgtcgaatataaatacatctttattgctggcatagatgaacaccccttcaataaaca |
4706683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 4702940 - 4702870
Alignment:
| Q |
8 |
caaataatgtaactgaccgaatgtattgaccccacaccaaattttttgcatcatagagtgtcccacaagta |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702940 |
caaataatgtaactgaccgaatgtattgaccccacaccaaattttttgcatcatagagtgtcccacaagta |
4702870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University