View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496_high_14 (Length: 268)
Name: NF2496_high_14
Description: NF2496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496_high_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 44474129 - 44473878
Alignment:
| Q |
18 |
gtatgcagtattttggttgctttgggaaatgtaaaataacccgagggagtactatttatcaagtataataaaattttgttattattctaagtcgttgtgt |
117 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474129 |
gtatgtagtattttggttgctttgagaaatgtaaaataacccgagggagtactatttatcaagtataataaaattttgttattattctaagtcgttgtgt |
44474030 |
T |
|
| Q |
118 |
aattttatgagaattgatcggttga-nnnnnnnnnnnnnnngggtggttccttggaatgtctatggtttcgaggttgcttgtttattttagtaacagttt |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474029 |
aattttatgagaattgatcggttgattttttttttttttttggggggttccttggaatgtctatggtttcgaggttgcttgtttattttagtaacagttt |
44473930 |
T |
|
| Q |
217 |
tctttatgccactggatggctacaatgtggcagtctttgaaattggtgatga |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44473929 |
tctttatgccactggatggctacaatgtggcagtctttgaaattggtgatga |
44473878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University