View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496_low_17 (Length: 250)
Name: NF2496_low_17
Description: NF2496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 51268659 - 51268872
Alignment:
| Q |
15 |
ggcatctataaaggccaacatgatcttcgagatcatttgaccgtcacaaatgttgttagtccatcgcgtgtgattgctccacctccaccaccggagaaac |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51268659 |
ggcatctataaaggccaacataatcttcgagatcatttgaccgtcacaaatgttgttagtccatcgcgtgtgattgctccacctccaccaccggagaaac |
51268758 |
T |
 |
| Q |
115 |
gttcagagaccaccggcgaccaccaacaccatgttgcatggactagtatccctcaagagagatgggaaggagaactgcttgttcaaggacatattccact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51268759 |
gttcagagaccaccggcgaccaccaacaccatgttgcatggactagtatccctcaagagagatgggaaggagaactgcttgttcaaggacatattccact |
51268858 |
T |
 |
| Q |
215 |
ctggctggtgagtg |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
51268859 |
ctggctggtgagtg |
51268872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 23306701 - 23306914
Alignment:
| Q |
15 |
ggcatctataaaggccaacatgatcttcgagatcatttgaccgtcacaaatgttgttagtccatcgcgtgtgattgctccacctccaccaccggagaaac |
114 |
Q |
| |
|
||||||||||||||||||| | |||||| |||||||||||||||| |||||| ||| ||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
23306701 |
ggcatctataaaggccaacgtaatcttcaagatcatttgaccgtcgcaaatgctgtgagtccatcgtgtgtgattgttccacctcaaccaccggagaaac |
23306800 |
T |
 |
| Q |
115 |
gttcagagaccaccggcgaccaccaacaccatgttgcatggactagtatccctcaagagagatgggaaggagaactgcttgttcaaggacatattccact |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23306801 |
gttcagagaccaccggtgaccaccaacaccatgttgcatggactagtatccatcaagagagatgggaaggagaactgcttgttcaaggacatattccact |
23306900 |
T |
 |
| Q |
215 |
ctggctggtgagtg |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23306901 |
ctggctggtgagtg |
23306914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University