View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496_low_20 (Length: 241)
Name: NF2496_low_20
Description: NF2496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 226
Target Start/End: Complemental strand, 35973935 - 35973738
Alignment:
| Q |
29 |
cagaacacactaatctgaggaacatatgttatgaataatgatatagattgtgaagacttactttctaggctaaattgtgaaaagtgaagttcaaaatccg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973935 |
cagaacacactaatctgaggaacatatgttatgaattatgatatagattgtgaagacttactttctaggctaaattgtgaaaagtgaagttcaaaatccg |
35973836 |
T |
 |
| Q |
129 |
agccaaatcttgaaggcaggattggacggcgagcttcattgatatactgccgcacggcggtttccactagatcgccgacagttgattccggcttcatc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35973835 |
agccaaatcttgaaggcaggattggacggcgagcttcattgatatactgccgcacggcggtttccactagatcgccgacagttgattccggtttcatc |
35973738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University