View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496_low_21 (Length: 240)
Name: NF2496_low_21
Description: NF2496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 105 - 226
Target Start/End: Complemental strand, 46582629 - 46582508
Alignment:
| Q |
105 |
cttcaagtaacacaaagaaactaaatcaagtgttaggtggagagttctgagaagattgttcttcttgtctagtttcttgctgagtattgataggtgttgc |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582629 |
cttcaagtagcacaaagaaactaaatcaagtgttaggtggagagttctgagaagattgttcttcttgtctagtttcttgctgagtattgataggtgttgc |
46582530 |
T |
 |
| Q |
205 |
aggaagtgaagtggtgctagtt |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46582529 |
aggaagtgaagtggtgctagtt |
46582508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 87
Target Start/End: Complemental strand, 46582736 - 46582700
Alignment:
| Q |
51 |
agatgaattcattgaatgtaactatatgaatcagtgc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582736 |
agatgaattcattgaatgtaactatatgaatcagtgc |
46582700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University