View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496_low_23 (Length: 223)
Name: NF2496_low_23
Description: NF2496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 41 - 206
Target Start/End: Complemental strand, 6866882 - 6866717
Alignment:
| Q |
41 |
tattttattaccaaagatgtattagtattataaaataaaaataattagaaacgacaaaatatttcagaaaagaaacatgcatttgatagtataagacaga |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6866882 |
tattttattaccaaagatgtattagtattataaaatgaaaataattagaaacgacaaaatatttcagaaaagaaacatgcatttgatagtataagacaga |
6866783 |
T |
|
| Q |
141 |
gagagtactctgtcaaaaaataaattatgattcttgtttttgtttttaaactcatgatctagtatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6866782 |
gagagtactctgtcaaaaaataaattatgattcttgtttttgtttttaaactcatgatctagtatt |
6866717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University