View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496_low_8 (Length: 383)
Name: NF2496_low_8
Description: NF2496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 36 - 276
Target Start/End: Complemental strand, 4172214 - 4171974
Alignment:
| Q |
36 |
tggtgaatgggaaccatagacccataaaaatgaaactatgtgtagcggaaccacatcccgtccatcttaagcgtgaagtgtgtgggtcaaatgggaaaga |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4172214 |
tggtgaatgggaaccatagacccataaaaatgaaactatgtgtagcggaaccacatcccgtccatcttaagcgtgaagtgtgtgggtcaaatgggaaaga |
4172115 |
T |
|
| Q |
136 |
aattgattgagcggaacgtgatgattgtttcagtgaaagaaaatgtacatatgattgggtttgaaacatgatgttctatggtgatggggcagaatggaga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4172114 |
aattgattgagcggaacgtgatgattgtttcagtgaaagaaaatgtacatatgattgggtttgaaacatgatgttctatggtgacggggcagaatggaga |
4172015 |
T |
|
| Q |
236 |
gttctagattaaacaataggcgtgcaactgatatatttgag |
276 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
4172014 |
gttctagataaaacaataggtgtgcaactgatatatttgag |
4171974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University