View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2497_low_11 (Length: 232)
Name: NF2497_low_11
Description: NF2497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2497_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 51844126 - 51843929
Alignment:
| Q |
16 |
aaaggcaactcgttaaacaaattgagaagggtgcgattgtggacatattattagtcctaattctatgttgatacaattttcattcaattggatgagttca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844126 |
aaaggcaactcgttaaacaaattgagaagggtgcgattgtggacatattattagtcctaattctatgttgatacaattttcattcaattggatgagttca |
51844027 |
T |
|
| Q |
116 |
agaataaacaaacctccaattggctgaactataagaattaactttaaatatccaaaatttgagagcgtgcgagaagatgtggattttgtagagttgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844026 |
agaataaacaaacctccaattggctgaactataagaattaactttaaatatccaaaatttgagagcgtgcgagaagatgtggattttgtagagttgaa |
51843929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 90 - 134
Target Start/End: Original strand, 51844957 - 51845001
Alignment:
| Q |
90 |
aattttcattcaattggatgagttcaagaataaacaaacctccaa |
134 |
Q |
| |
|
||||||||| ||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
51844957 |
aattttcatgcaattggttgagttcaagagtaaataaacctccaa |
51845001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University