View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2497_low_7 (Length: 296)

Name: NF2497_low_7
Description: NF2497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2497_low_7
NF2497_low_7
[»] chr8 (3 HSPs)
chr8 (195-288)||(13467871-13467964)
chr8 (1-150)||(13471843-13471991)
chr8 (248-285)||(13472021-13472058)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 9e-39; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 195 - 288
Target Start/End: Original strand, 13467871 - 13467964
Alignment:
195 atccaaaacaacaaaatccaagtagtcacttaacctatgttcatgtatgtcccttgacaattgctattttcaaaccctatcagtcagttcatat 288  Q
    ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
13467871 atccaaaacaacaaaatccaactagtgacttaacctatgttcatgtatgtcccttgacaattgctattttcaaaccatatcagtcagttcatat 13467964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 13471843 - 13471991
Alignment:
1 aaattcaagtattggctaactaacaaatatgcaattcaatgttttaaaagggatcgaaacaaaataaatctttgatgatcacagagttcatagagcacaa 100  Q
    ||||||| || ||||||||||||||||||||||||||||| | ||||||| |||| || |||||| |||| ||||| ||||||||| |||||||||||||    
13471843 aaattcatgtcttggctaactaacaaatatgcaattcaatttcttaaaagtgatcaaagcaaaattaatcattgataatcacagagctcatagagcacaa 13471942  T
101 tatgtcactcaccaaactagttgcaaaacctatgaacatatacacttcaa 150  Q
    ||| |  || ||||||||||||||||||||| ||| || ||| |||||||    
13471943 tatat-gcttaccaaactagttgcaaaacctgtgagcagatatacttcaa 13471991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 248 - 285
Target Start/End: Original strand, 13472021 - 13472058
Alignment:
248 ttgacaattgctattttcaaaccctatcagtcagttca 285  Q
    ||||||||||||||||||||| ||||||||||||||||    
13472021 ttgacaattgctattttcaaatcctatcagtcagttca 13472058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University