View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_high_23 (Length: 341)
Name: NF2498_high_23
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 6 - 333
Target Start/End: Original strand, 36128129 - 36128456
Alignment:
| Q |
6 |
acctgatcttttcctcttcttctcatcatttgtagtacctttctcaactacctcttcttcacttttctttgacaccaatacatcatccattcttgaatcc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36128129 |
acctgatcttttcctcttcttctcatcatttgtagtacctttctcaactacctcttcttcacttttctttgacaccaatacatcatccattcttgaatcc |
36128228 |
T |
 |
| Q |
106 |
tcttcatgagggtccattttgtcttgcacctcgttttgcttttcagcctcaactagatttttgttattctcacccccaccaccttgataaacctcttcca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36128229 |
tcttcatgagggtccattttgtcttgcacctcgttttgcttttcagcctcaactagatttttgttattctcacccccaccaccttgataaacctcttcca |
36128328 |
T |
 |
| Q |
206 |
gctcagtaacaaacctaaaattcttaccaaaactattttgattatgattaatgttgttgaaaaatctgctttcttcttcaaatttttccttgcatttttc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36128329 |
gctcagtaacaaacctaaaattcttaccaaaactattttgattatgattaatgttgttgaaaaatctgctttcttcttcaaatttttccttgcatttttc |
36128428 |
T |
 |
| Q |
306 |
agcactacgtttataaccaacctatgct |
333 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
36128429 |
agcactacgtttataaccaacctctgct |
36128456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University