View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_high_31 (Length: 312)
Name: NF2498_high_31
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 10 - 178
Target Start/End: Complemental strand, 43190539 - 43190374
Alignment:
| Q |
10 |
aagaatataaaatgccgtctgttaattgattaactaagactagatgttgtgataaggtacaagtaatgcgtacaaataactggatggtctagtaacagta |
109 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43190539 |
aagaaaataaaatgccgtctgtgaattgattaactaagactagatgttgtgataaggtacaagtaatgcgtacaaataactggatggtctagtaac---a |
43190443 |
T |
 |
| Q |
110 |
gtaatagtgcatgacaaagctattgataccaacagcaacggcaaggagaaaaacaaccatccacgtttc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43190442 |
gtaatagtgcatgacaaagctattgataccaacagcaacggcaaggagaaaaacaaccatccacgtttc |
43190374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 214 - 295
Target Start/End: Complemental strand, 43190369 - 43190288
Alignment:
| Q |
214 |
cttttcaaaacatctaataaattgcgtcaaaataaataattcaatgaagatgattatatacttgggaaacaccgtacgtaaa |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43190369 |
cttttcaaaacatctaataaattgcgtcaaaataaataattcaatgaagatgattatatatttgggaaacaccgtacgtaaa |
43190288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University