View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_high_35 (Length: 297)
Name: NF2498_high_35
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 13 - 172
Target Start/End: Complemental strand, 47527573 - 47527414
Alignment:
| Q |
13 |
aaaatattggccgcgaacttcacggcaccgatggagatacttaagtcagggttcaacttcttatgagcagaataaacttgacgtccaaatggaaaccatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47527573 |
aaaatattggccgcgaacttcacggcaccgatggagatacttaagtcagggttcaacttcttatgagcagaataaacttgacgtccaaatagaaaccatt |
47527474 |
T |
 |
| Q |
113 |
caatctttttgcgtgccttcttctccaccggtggttgttccatcgatgcttgatcaaagg |
172 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47527473 |
caatctttttgcgtgcctttttctccatcggtggttgttccatcgatgcttgatcaaagg |
47527414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 225
Target Start/End: Complemental strand, 47527403 - 47527369
Alignment:
| Q |
191 |
cttgtgttattgaatgaaaatcttttagttgacta |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47527403 |
cttgtgttattgaatgaaaatcttttagttgacta |
47527369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 246 - 280
Target Start/End: Complemental strand, 47527356 - 47527322
Alignment:
| Q |
246 |
gattcttggttcactgattattaacaggtaagaaa |
280 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47527356 |
gattcttggttcactaattattaacaggtaagaaa |
47527322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University