View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2498_high_42 (Length: 262)

Name: NF2498_high_42
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2498_high_42
NF2498_high_42
[»] chr4 (1 HSPs)
chr4 (1-104)||(52996814-52996918)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 52996814 - 52996918
Alignment:
1 gtttcacacaaaaataaa-gaagttaataaaaaattactttaaaggaatgtggtactataattgatattactttgtatttcaatttacttgatatataaa 99  Q
    |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52996814 gtttcacacaaaaaaaaaagaagttaataaaaaattactttaaaggaatgtggtactataattgatattactttgtatttcaatttacttgatatataaa 52996913  T
100 actac 104  Q
    |||||    
52996914 actac 52996918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University