View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_high_52 (Length: 244)
Name: NF2498_high_52
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_high_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 41298040 - 41297815
Alignment:
| Q |
1 |
ccgcttgttatgttctctaccccagatgtcatcacagtctgacgggtatcctcccttcgaacgtgtgcataagcctgctcgattgtgggaaattgtttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41298040 |
ccgcttgttatgttctctaccccagatgtcatcacagtctgacgggtgtcctcccttcgaacatgtgcataagcctgctcgattgtgggaaatggtttca |
41297941 |
T |
 |
| Q |
101 |
gttggaggatgtcactccaaatgttatctagtcggtcattcaacccatccnnnnnnntataaactatttcctcctgtaatagagaattgaatttttgtat |
200 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41297940 |
gttgaaggatgtcactccgaatgttatctagtcggtcattcaacccatccaaaaaaatataaactctttcctcctgtaatagagaattgaatttttgtat |
41297841 |
T |
 |
| Q |
201 |
gtcttttgggcactccatggggttag |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41297840 |
gtcttttgggcactccatggggttag |
41297815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University