View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_high_53 (Length: 243)
Name: NF2498_high_53
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_high_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 101 - 225
Target Start/End: Original strand, 27710124 - 27710247
Alignment:
| Q |
101 |
tggtcttcgctttgtgtcatcacgtacaagaaaaattatgcccaaacagtcaacgcatccgctctcaaatgttaacttcttattagcaacgttgagtctc |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27710124 |
tggtcttcgctttgtgtcttcacgtacaagaaaaattatgcccaaacagtcaacgcatccgctctcaaatgttaacttcttattagcaacgttg-gtctc |
27710222 |
T |
 |
| Q |
201 |
aaatctatctatattagtacagttt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27710223 |
aaatctatctatattagtacagttt |
27710247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 4 - 47
Target Start/End: Original strand, 27708759 - 27708802
Alignment:
| Q |
4 |
aagtagccataaaccacacaagaagccgaaacaaacactacaac |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27708759 |
aagtagccataaaccacacaagaagccgaaacaaacactacaac |
27708802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University