View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2498_high_63 (Length: 227)

Name: NF2498_high_63
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2498_high_63
NF2498_high_63
[»] chr8 (1 HSPs)
chr8 (13-207)||(13271884-13272085)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 13 - 207
Target Start/End: Complemental strand, 13272085 - 13271884
Alignment:
13 gagatgaaggtatatttaaaataaaagaagtaaataattgaccaagaaaaaacattagacggctaaccaatgaaacttaattccgacacaacttgtcaat 112  Q
    ||||||||| ||||||||||| || || |||| ||||||||||||| ||| ||||||||||| || |||||||||||||||||||||||||||||| |||    
13272085 gagatgaagatatatttaaaacaagaggagtagataattgaccaaggaaagacattagacggatagccaatgaaacttaattccgacacaacttgttaat 13271986  T
113 tcatagtttccccaacttgaatta------taccaataaaaactaccaaccatatgttcataaccataaacaaacaatcaaaataac-ttgagtggtgat 205  Q
    |||||||||| |||||||| || |      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
13271985 tcatagtttcaccaacttgtatgataccattaccaataaaaactaccaaccatatgttcataaccataaacaaacaatcaaaataactttgagtggtgat 13271886  T
206 cg 207  Q
    ||    
13271885 cg 13271884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University