View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_high_68 (Length: 206)
Name: NF2498_high_68
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_high_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 129 - 189
Target Start/End: Original strand, 17451668 - 17451728
Alignment:
| Q |
129 |
cgattgattatccttaatctaatcgcttggtggatcttttgtttcccttagccagcattca |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17451668 |
cgattgattatccttaatctaatcgcttggtggatcttttgtttcccttcgccagcattca |
17451728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 125 - 163
Target Start/End: Original strand, 42758892 - 42758930
Alignment:
| Q |
125 |
ttgtcgattgattatccttaatctaatcgcttggtggat |
163 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42758892 |
ttgtcgattgattacccttaatctaatcgcttggtggat |
42758930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University