View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_high_69 (Length: 204)
Name: NF2498_high_69
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_high_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 50102050 - 50102221
Alignment:
| Q |
18 |
gtaacaattaaatacattgtcgattcagatttcgatgagcttgatatgattaaagactatcaaaaatatatgttttatgattgctctgtctgtagtaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50102050 |
gtaacaattaaatacattgtcgattcagatttagatgagcttgatatgattaaagaccatcaaaaatatatgttttatgattgctctgtctgtagtaaat |
50102149 |
T |
 |
| Q |
118 |
ggcctgggaaaaagcactggagggtaaccattactatgttgatctaattgtttcttgggttatgtttttcat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50102150 |
ggcctgggaaaaagcactggagggtaaccattactatgttgatctaattgtttcttgggttatgtttttcat |
50102221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University