View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_high_8 (Length: 565)
Name: NF2498_high_8
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 2e-53; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 423 - 549
Target Start/End: Complemental strand, 14214662 - 14214536
Alignment:
| Q |
423 |
ggtgagaaaatggggcaaggagtggagacaatagcttaacccatcttcgggcatattaggagcggccagaatcatttggaagttaaggaatcatcaacca |
522 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||| |
|
|
| T |
14214662 |
ggtgagaaaatggggcaaggagtggagacaatagcttaacccatcttcgggcatattaggagcggccagaatcattcggaagtcaatgaatcatcaaccg |
14214563 |
T |
 |
| Q |
523 |
atgaacctttatttatgtttttctttt |
549 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
14214562 |
atgaacctttatttatgtgtttctttt |
14214536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 228 - 344
Target Start/End: Complemental strand, 14214865 - 14214752
Alignment:
| Q |
228 |
gcaaactgataaatttttattgatgacagaaaatcatacatacagggttttggctcctttatgtagtcattttagacttaaagtagcaagtttggtattg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14214865 |
gcaaactgataaatttttattgatgacagaaaatcataca---aggtttttggctcctttatatagtcattttagacttaaagtagcaagtttggtattg |
14214769 |
T |
 |
| Q |
328 |
tatttagttgagttttg |
344 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14214768 |
tatttagttgagttttg |
14214752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 217
Target Start/End: Complemental strand, 14214969 - 14214926
Alignment:
| Q |
174 |
aatgatacaattattttccacatacatctacgatggacataaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14214969 |
aatgatacaattattttccacatacatctaagatggacataaag |
14214926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University