View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_low_21 (Length: 377)
Name: NF2498_low_21
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 138 - 360
Target Start/End: Complemental strand, 54339246 - 54339024
Alignment:
| Q |
138 |
cacgtcaataaataataatacctggatataatcttatagaaaaaattggttgggattaccaaattacatgggaaaagtatagcaagccaaaaaatttatc |
237 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54339246 |
cacgtcaataaataataatacctgcatataatcttatagaaaaaattggttgggattaccaaattacatgggaaaagtatagcaagccaaaaaatttatc |
54339147 |
T |
 |
| Q |
238 |
aaattagtcaacaatgtctatcattcttgtgtctttttggtcgagacggttattaatttgattcagctaatccaccaagctagacagtgtgacatgaaag |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
54339146 |
aaattagtcaacaatgtctaccattcttgtgtctttttggtcgagacggttattaatttgattcagctaatccaccaagttagacagtgtgacatgaacg |
54339047 |
T |
 |
| Q |
338 |
tggactataaacacgttaggttt |
360 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
54339046 |
aggactataagcacgttaggttt |
54339024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 54339383 - 54339307
Alignment:
| Q |
1 |
atagcctaagaataatgtggatcatatattatctacaaaataaaaaagttgaatgtttttggtctccatatttgaac |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54339383 |
atagcctaagaataatgtggatcatatattatctacaaaataaaaaagttgaatgtttttggtctccatatttgaac |
54339307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University