View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2498_low_34 (Length: 312)

Name: NF2498_low_34
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2498_low_34
NF2498_low_34
[»] chr7 (2 HSPs)
chr7 (10-178)||(43190374-43190539)
chr7 (214-295)||(43190288-43190369)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 10 - 178
Target Start/End: Complemental strand, 43190539 - 43190374
Alignment:
10 aagaatataaaatgccgtctgttaattgattaactaagactagatgttgtgataaggtacaagtaatgcgtacaaataactggatggtctagtaacagta 109  Q
    ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |    
43190539 aagaaaataaaatgccgtctgtgaattgattaactaagactagatgttgtgataaggtacaagtaatgcgtacaaataactggatggtctagtaac---a 43190443  T
110 gtaatagtgcatgacaaagctattgataccaacagcaacggcaaggagaaaaacaaccatccacgtttc 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43190442 gtaatagtgcatgacaaagctattgataccaacagcaacggcaaggagaaaaacaaccatccacgtttc 43190374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 214 - 295
Target Start/End: Complemental strand, 43190369 - 43190288
Alignment:
214 cttttcaaaacatctaataaattgcgtcaaaataaataattcaatgaagatgattatatacttgggaaacaccgtacgtaaa 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
43190369 cttttcaaaacatctaataaattgcgtcaaaataaataattcaatgaagatgattatatatttgggaaacaccgtacgtaaa 43190288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University