View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_low_5 (Length: 640)
Name: NF2498_low_5
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-159; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 21 - 309
Target Start/End: Original strand, 44424125 - 44424413
Alignment:
| Q |
21 |
aaatgtacagtcatcagagacctttatcattgcaaacagtttcatgtctagtccaataatattcactcttagtgtatttcaggtgaaatctcggacaatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424125 |
aaatgtacagtcatcagagacctttatcattgcaaacagtttcatggctagtccaataatattcactcttagtgtatttcaggtgaaatctcggacaatg |
44424224 |
T |
 |
| Q |
121 |
gaagttgctaagttgattgagagtgaagatggcgttgctgcagcagttgacgcgtttcatcgccacctgcccgatgagctaccgctgccaactccatctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424225 |
gaagttgctaagttgattgagagtgaagatggcgttgctgcagcagttgacgcgtttcatcgccacctgcccgatgagctaccgctgccaactccatctc |
44424324 |
T |
 |
| Q |
221 |
atgtggaagacgaggaccacttaagtcctcttaattggttttttgaccaacttgcaaagtggtgttgtttgccttgtggtggtgtgtag |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424325 |
atgtggaagacgaggaccacttaagtcctcttaattggttttttgaccaacttgcaaagtggtgttgtttgccttgtggtggtgtgtag |
44424413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 130; E-Value: 5e-67
Query Start/End: Original strand, 493 - 630
Target Start/End: Original strand, 44424553 - 44424690
Alignment:
| Q |
493 |
tagatattagatttcacccctccccctcaaacattttgcataggaggttatgtcatttgttgtagattaagagttgagagttctacttacataaagaact |
592 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424553 |
tagatattagatttcacccctccccctcaaacattttgtataggaggttatgtcaattgttgtagattaagagttgagagttctacttacataaagaact |
44424652 |
T |
 |
| Q |
593 |
ctgctaggtgtttttgtttgatagttgatgatgatgtc |
630 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424653 |
ctgctaggtgtttttgtttgatagttgatgatgatgtc |
44424690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 374 - 435
Target Start/End: Original strand, 44424478 - 44424539
Alignment:
| Q |
374 |
gataggaactttctgttattacagaatggtagcataatgttttggtttggtatttcattcat |
435 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424478 |
gatagaaactttctgttattacagaatggtagcataatgttttggtttggtatttcattcat |
44424539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University