View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_low_55 (Length: 249)
Name: NF2498_low_55
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_low_55 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 31118060 - 31118298
Alignment:
| Q |
10 |
atgaaaacctatcatgacacgtggcatgattattcggatttaggcataatgtccacgtgggtcccattaggacaagcatgtgtcatagagagggggaaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
31118060 |
atgaaaacctatcatgacacgtggcatgattattcggatttaggcataatgtccacgtgggtcccattaggacaagcatgtgtcatggagagggg-aaag |
31118158 |
T |
 |
| Q |
110 |
ggatggaaaacaagtgagagcacatggagagagcatcctatatttttcccttataaatagccctttcatacgttacatgttccaacacacacatctttta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31118159 |
ggatggaaaacaagtgagagcacatggagagagcatcctatatttttcccttataaatagccctttcatacgttacatgttccaacacacacatctttta |
31118258 |
T |
 |
| Q |
210 |
ccgatcacgtgctttcctcttctttttctctgctctttct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31118259 |
tcgatcacgtgctttcctcttctttttctctgctctttct |
31118298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University