View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_low_62 (Length: 242)
Name: NF2498_low_62
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 113 - 227
Target Start/End: Complemental strand, 12622991 - 12622877
Alignment:
| Q |
113 |
ggatgggaatgtaatattaggaagctataacagtgtgccgccacgacaccaataaccaatgaattcctgaagttcgagatatagactcctataatgatca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12622991 |
ggatgggaatgtaatattaggaagctataacagtgtgccgccacgacaccaataaccaatgaattcctgaagttcgagatatagactcctataatgatca |
12622892 |
T |
 |
| Q |
213 |
acagaaaaacttagt |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12622891 |
acagaaaaacttagt |
12622877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 12623086 - 12623028
Alignment:
| Q |
16 |
aagaaagacattattcagcaaagtttaggtgcatagcaggaatgaatatgaaaccgatg |
74 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12623086 |
aagaaagacattattcagcaatgtttaggtgcatagcaggaatgaatatgaaaccgatg |
12623028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 12629017 - 12628961
Alignment:
| Q |
18 |
gaaagacattattcagcaaagtttaggtgcatagcaggaatgaatatgaaaccgatg |
74 |
Q |
| |
|
||||||||||||| |||| |||| ||||||| || |||||||||||||||| |||| |
|
|
| T |
12629017 |
gaaagacattattatgcaatgtttgggtgcatcgctggaatgaatatgaaacagatg |
12628961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University