View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_low_63 (Length: 239)
Name: NF2498_low_63
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 36061449 - 36061668
Alignment:
| Q |
1 |
ttagaaaccttagaaagattggtttgttttctagttattgataattttgatgaaccatattagccaataggcttgcat--tctttctcattagagagagt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36061449 |
ttagaaaccttagaaagattggtttgttttctagttattgataattttgatgaaccatattagccaataggcttgcattctctttctcattagagagagt |
36061548 |
T |
 |
| Q |
99 |
gacagatccagccataagtgactcagtctatactctgtaatgggatcttattagttattacttcattatgataataaaattgttatttaaactttgcgaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36061549 |
gacagatccagccataagtgactcagtctatactctgtaatgggatc-------ttattacttcattatgataataaaattgttatttaaactttgcgaa |
36061641 |
T |
 |
| Q |
199 |
cccattctctataatgtagatccaaat |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
36061642 |
cccattctctataatgtagatccaaat |
36061668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University