View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_low_76 (Length: 210)
Name: NF2498_low_76
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_low_76 |
 | |
|
| [»] scaffold0011 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0011 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 110 - 195
Target Start/End: Complemental strand, 247760 - 247675
Alignment:
| Q |
110 |
aatatgtttgggtgtttgaagggacgggtcatgtgtgattgtgattctgtttcgattattactgttgttattgctgctgtcctttg |
195 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
247760 |
aatatgtttgggtttttgaaggggcgggtcatgtgtgattgtgattctgtttcgattattactgttgttattgctgctgtcctttg |
247675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 97
Target Start/End: Complemental strand, 247862 - 247784
Alignment:
| Q |
19 |
tgaaccacttgagattcttcttcatcttcctttgcttgctgaggataaggtaaatttccaacaaatttaattctgtctg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
247862 |
tgaaccacttgagattcttcttcatcttcctttgcttgctgaggataaggtaaatttccaacaaatttaattttgtctg |
247784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 46987764 - 46987815
Alignment:
| Q |
19 |
tgaaccacttgagattcttcttcatcttcctttgcttgctgaggataaggta |
70 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
46987764 |
tgaacctcttgagattcttctccatcttcctctacttgctgaggataaggta |
46987815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University