View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2498_low_76 (Length: 210)

Name: NF2498_low_76
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2498_low_76
NF2498_low_76
[»] scaffold0011 (2 HSPs)
scaffold0011 (110-195)||(247675-247760)
scaffold0011 (19-97)||(247784-247862)
[»] chr4 (1 HSPs)
chr4 (19-70)||(46987764-46987815)


Alignment Details
Target: scaffold0011 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 110 - 195
Target Start/End: Complemental strand, 247760 - 247675
Alignment:
110 aatatgtttgggtgtttgaagggacgggtcatgtgtgattgtgattctgtttcgattattactgttgttattgctgctgtcctttg 195  Q
    ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
247760 aatatgtttgggtttttgaaggggcgggtcatgtgtgattgtgattctgtttcgattattactgttgttattgctgctgtcctttg 247675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 97
Target Start/End: Complemental strand, 247862 - 247784
Alignment:
19 tgaaccacttgagattcttcttcatcttcctttgcttgctgaggataaggtaaatttccaacaaatttaattctgtctg 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
247862 tgaaccacttgagattcttcttcatcttcctttgcttgctgaggataaggtaaatttccaacaaatttaattttgtctg 247784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 46987764 - 46987815
Alignment:
19 tgaaccacttgagattcttcttcatcttcctttgcttgctgaggataaggta 70  Q
    |||||| |||||||||||||| ||||||||| | ||||||||||||||||||    
46987764 tgaacctcttgagattcttctccatcttcctctacttgctgaggataaggta 46987815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University